
vchal / Shutterstock.com
The genetic code is one of the most important aspects of the life sciences. All of the instructions necessary for the growth and day-to-day functioning of all living organisms are contained within. These guidelines are encoded and correspond to specific amino acids that make up proteins, which are responsible for the majority of our bodily functions. Understanding how genes are expressed helps scientists study the genetic code at a deeper level, as well aseditit. There are three-letter combinations for all of these amino acids, which are known as codons. While we can represent these combinations in atable, another convenient way to reference them is with a codon chart. By using a codon chart, you can quickly and easily determine which amino acid is being coded for by your codon.
In this article, we re going to provide you with such a chart and explain how to use it. If you re studying chemistry or biochemistry, you may find ourmolecular geometryandelectronegativitycharts helpful as well.
What is a Codon Chart?
Codon charts are simply a visual representation of each combination of bases that make up amino acids. They can be used to map either DNA or RNA sequences, as there are differences in the nucleotides that make up DNA and RNA. Whereas DNA consists of the bases adenine (A), thymine (T), cytosine (C) and guanine (G), RNA has uracil (U) instead of thymine. But the overall objective of mapping codons to their corresponding amino acids remains the same.
While the sequences in a codon chart correspond to amino acids, some of them correspond to start and stop codons as well. For example, methionine is usually coded for as a start codon, since it s usually the first amino acid in a protein sequence. However, stop codons don t relate to any amino acid, but are simply a combination of bases used to terminate protein synthesis and to signal the release of the protein from the ribosome.
How to Use a Codon Chart
Fortunately, the process of using a codon chart is a lot simpler than the underpinning theories. To begin, you ll need the DNA or RNA sequence for which you want to find the corresponding amino acids. You ll usually obtain this experimentally or via bioinformatics or a public database.
Once you have your sequence, it s time to split it up into codons. Since each codon is made up of three bases, all you need to do is split your sequence into three-base sections to obtain the codons.
Next, consult the codon chart. To find the amino acid, begin at the center, with the first base in your codon. This will narrow down your search to one of the four quadrants. After that, move to the next circle, and find the second codon base out of the four choices. To finish, locate your last base in the final circle, usually giving you one of two choices. There will be a name of an amino acid just outside of this section, which corresponds to your codon.
To find the entire amino acid sequence, simply repeat these steps for every codon in your sequence.
Using the Codon Chart An Example
To illustrate, let s say we have the following RNA sequence:
AUGUCCGAUCAUCGAGUCUAA
we can split this up into the following codons for easier reference:
AUG UCC GAU CAU CGA GUC UAA
Using the chart, we identify the amino acids as the following:
Methionine, Serine, Aspartic acid, Histidine, Arginine, Valine, Stop
As mentioned before, methionine is usually the start codon. We can also see we have a stop codon at the end of our sequence, as expected.

History-Computer.com
Wrapping Up
To summarize, the genetic code is essentially the blueprint for all life and consists of nucleotides. These nucleotides are grouped into threes, which are known as codons. Every codon, whether from DNA or RNA, translates to a specific amino acid, which is the building block of proteins. Codon charts are an extremely useful tool for identifying these amino acids, in any given DNA or RNA sequence. As such, these charts are indispensable in the life sciences and represent the efforts that have gone into understanding the structure of genes. If you re working within any area of biology, codon charts are invaluable forstudying genesand gene expression.